yerD [2020-04-11 17:37:17]

general stress protein, similar to glutamate synthase (ferredoxin), required for protection against paraquat stress

Locus: BSU_06590

Isoelectric point: 7.35

Molecular weight: 58.58 kDa

Protein length: 525 aa

Gene length: 1578 bp

Function: protection against paraquat stress

Product: unknown

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress
• Groups of genes → Membrane proteins
• Groups of genes → Poorly characterized/ putative enzymes

Gene

Coordinates: 716,780 → 718,357

The protein

Protein family

• glutamate synthase family (with GltA and GltB, according to UniProt)

Paralogous protein(s)

• GltA

Cofactors

• FMN or FAD PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: yerD
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon

  Regulation

  • induced by stress (SigB) PubMed

Biological materials

Mutant

• MGNA-A925 (yerD::erm), available at the NBRP B. subtilis, Japan
• GP1184 (tet) available in Jörg Stülke's lab
• BKE06590 (ΔyerD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT, downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
• BKK06590 (ΔyerD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT, downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA

Expression vectors

• pBP32 (expression vector for E. coli BL21; N-terminal Strep-tag-YerD fusion protein, based on pGP172), available in Fabian Commichau's lab

FLAG-tag construct

• GP1187 (spc, based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Fabian Commichau, Göttingen, Germany homepage

References

Loading