sigV [2019-04-14 15:41:37]

RNA polymerase ECF-type sigma factor SigV, required for resistance to lytic enzymes

Locus: BSU27120

Isoelectric point: 9.04

Molecular weight: 19.57 kDa

Protein length: 166 aa

Gene length: 501 bp

Function: resistance to lytic enzymes

Product: RNA polymerase ECF-type sigma factor SigV

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

Gene

Coordinates: 2,769,850 → 2,770,350

Phenotypes of a mutant

• increased sensitivity to lysozyme, this can be suppressed by overexpression of oatA PubMed

The protein

Protein family

• ECF subfamily (according to Swiss-Prot)

Effectors of protein activity

• activity is controlled by the interaction with RsiV, proteolytic degradation of RsiV releases active SigV PubMed

Structure

• 5WUQ (the SigW-RsiW complex, 28% identity for SigV) PubMed

Additional information

• Expression of the SigV regulon in increased in ugtP mutants PubMed

Expression and Regulation

Operons

• Genes: sigV-rsiV-oatA-yrhK
  Description: PubMed

  Sigma factors

  • SigV: sigma factor, PubMed, in SigV regulon

  Regulation

  • induced by lysozyme (SigV) PubMed

  Additional information

  • A ncRNA (RnaC) is encoded between 'yrhK' and 'yrhJ' PubMed

Biological materials

Mutant

• MGNA-A144 (sigV::erm), available at the NBRP B. subtilis, Japan
• 1A907 ( sigV::kan), PubMed, available at BGSC
• BKE27120 (ΔsigV::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT, downstream forward: _UP4_TTGACGAAGGAGGATCTTTC
• BKK27120 (ΔsigV::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT, downstream forward: _UP4_TTGACGAAGGAGGATCTTTC

Labs working on this gene/protein

• Thomas Wiegert, University of Bayreuth, Germany Wiegert-Dateien/Thomas Wiegert.html Homepage

References

Reviews

Loading

Original publications

Loading