speD

S-adenosylmethionine decarboxylase, required for biofilm formation

Locus: BSU_29010

Isoelectric point: 4.77

Molecular weight: 13.96 kDa

Protein length: 126 aa

Gene length: 381 bp

Function: spermidine, polyamine biosynthesis

Product: S-adenosylmethionine decarboxylase

Essential: no

E.C.: 4.1.1.50

Synonyms: ytcF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Metabolism of polyamines
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation

Gene

Coordinates: 2,966,413 → 2,966,793

Phenotypes of a mutant

• no biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• H⁺ + S-adenosyl-L-methionine --> CO₂ + S-adenosyl 3-(methylsulfanyl)propylamine (according to UniProt)

Protein family

• prokaryotic AdoMetDC family (single member, according to UniProt)

Structure

• 1VR7 (from Thermotoga maritima, 47% identity, 72% similarity)

Expression and Regulation

Operons

• Genes: gapB-speD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpN: repression, PubMed, in CcpN regulon

  Regulation

  • gapB: repressed in the presence of glucose (CcpN) PubMed

  Additional information

  • 'speD': the mRNA is substantially stabilized upon depletion of RNase Y (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) PubMed

• Genes: speD
  Description: PubMed

  Regulation

  • gapB: repressed in the presence of glucose (CcpN) PubMed

  Additional information

  • 'speD': the mRNA is substantially stabilized upon depletion of RNase Y (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) PubMed

Biological materials

Mutant

• MGNA-A122 (ytcF::erm), available at the NBRP B. subtilis, Japan
• BKE29010 (ΔspeD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTCATGGACCCCCCTT, downstream forward: _UP4_TAAAGTAAATTGCGAACACA
• BKK29010 (ΔspeD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTCATGGACCCCCCTT, downstream forward: _UP4_TAAAGTAAATTGCGAACACA
• GP2599 (ΔspeD::tet comIQ12L) (in DK1042), available in Jörg Stülke's lab

Expression vector

• pGP2324: for expression in B. subtilis, in pBQ200,available in Jörg Stülke's lab

References

Loading