qoxC [2019-06-28 12:57:11]

cytochrome aa3 quinol oxidase (subunit III)

Locus: BSU38150

Isoelectric point: 6.24

Molecular weight: 22.53 kDa

Protein length: 204 aa

Gene length: 615 bp

Function: respiration

Product: cytochrome aa3 quinol oxidase (subunit III)

Essential: no

E.C.: 1.10.3.-

Synonyms: ipa-39d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → Respiration → Terminal oxidases
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,914,691 → 3,915,305

The protein

Catalyzed reaction/ biological activity

• Ubiquinol-8 + O₂ = Ubiquinone-8 + H₂O (according to Swiss-Prot)

Protein family

• cytochrome c oxidase subunit 3 family (according to Swiss-Prot)

Structure

• 1FFT (QoxA-QoxB-QoxC complex from E. coli, 52% identity) PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: qoxA-qoxB-qoxC-qoxD
  Description: PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • CitB: mRNA binding, in CitB regulon

  Regulation

  • RelA dependent downregulation (Class I) during stringent response PubMed

  Additional information

  • the presence of an iron-responsive element bound by CitB between feuA and feuB suggests iron-dependent regulation by CitB PubMed

Biological materials

Mutant

• BKE38150 (ΔqoxC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACTCACGCCTCCTTAT, downstream forward: _UP4_GGTGTCTATCTCATGGGATTG
• BKK38150 (ΔqoxC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACTCACGCCTCCTTAT, downstream forward: _UP4_GGTGTCTATCTCATGGGATTG
• GP2579 (ΔqoxC::tet comIQ12L) (in DK1042) available at Jörg Stülke's lab

References

Loading