icd

isocitrate dehydrogenase

Locus: BSU_29130

Isoelectric point: 4.83

Molecular weight: 46.26 kDa

Protein length: 423 aa

Gene length: 1272 bp

Function: TCA cycle

Product: isocitrate dehydrogenase

Essential: no

E.C.: 1.1.1.42

Synonyms: citC

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 2,979,716 → 2,980,987

Phenotypes of a mutant

• reduced ability to sporulate PubMed
• growth and sporulation defects of the mutant could be partially bypassed by deletion of the major citrate synthase gene (citZ) PubMed

The protein

Catalyzed reaction/ biological activity

• isocitrate + NADP⁺ --> 2-oxoglutarate + CO₂ + NADPH (according to UniProt)

Protein family

• Isocitrate and isopropylmalate dehydrogenases family (with LeuB and YcsA, according to UniProt)

Paralogous protein(s)

• YcsA

Modification

• phosphorylated on Arg-180 PubMed
• phosphorylated PubMed, PubMed
• in vitro phosphorylated by PrkC on Thr-138, Thr-147, and Thr-396 PubMed

Cofactors

• Mg²⁺, Mn²⁺, NADP⁺

Effectors of protein activity

• Inhibited by glyoxylate, oxaloacetate and oxalomalate PubMed

Structure

• 1HQS PubMed

Additional information

• This enzyme requires NADP+ exclusively. No activity was seen on the presence on NAD+ PubMed
• extensive information on the structure and enzymatic properties of Icd can be found at Proteopedia
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: icd-mdh
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, CcpC: transcription repression PubMed, in CcpA regulon
  • CcpC: repression, (molecular inducer: citrate) PubMed, in CcpC regulon

  Regulation

  • citZ: catabolite repression (CcpA) PubMed

• Genes: citZ-icd-mdh
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, CcpC: transcription repression PubMed, in CcpA regulon
  • CcpC: repression, (molecular inducer: citrate) PubMed, in CcpC regulon
  • CitB: mRNA destabilization, upon citrate accumulation or iron limitation PubMed, in CitB regulon

  Regulation

  • CitZ: catabolite repression (CcpA) PubMed

Biological materials

Mutant

• GP666 (spc), GP672 (erm), available in Jörg Stülke's lab
• 1A1000 ( icd::spec), [Pubmed| ], available at BGSC
• 1A999 ( icd::spec), [Pubmed| ], available at BGSC
• GP790 Δ(citZ-icd-mdh)::kan, available in Jörg Stülke's lab
• GP2331 Δ(citZ-icd-mdh)::kan, Cre-recombinase is integrated in sacA,available in Jörg Stülke's lab
• GP2333 Δ(citZ-icd-mdh)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• BKE29130 (Δicd::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
• BKK29130 (Δicd::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA

Expression vectors

• pGP1121 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Jörg Stülke's lab) PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Linc Sonenshein's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage

References

Loading