bofA [2019-03-31 16:37:36]

inhibition of the pro-sigma-K processing machinery

Locus: BSU00230

Isoelectric point: 9.32

Molecular weight: 8.87 kDa

Protein length: 87 aa

Gene length: 264 bp

Function: control of SigK activation

Product: inhibitor of pro-SigK processing

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Sigma factors and their control → Control of sigma factors
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 29,772 → 30,035

The protein

Localization

• integral mother cell membrane protein PubMed

Expression and Regulation

Operons

• Genes: dnaX-yaaK-recR-yaaL-bofA
  Description: PubMed

• Genes: bofA
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulatory mechanism

  • SpoIIID: repression, PubMed, in SpoIIID regulon

  Regulation

  • expressed during sporulation PubMed

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• MGNA-A081 (bofA::erm), available at the NBRP B. subtilis, Japan
• 1S100 ( bofA::cat), PubMed, available at BGSC
• 1S96 ( bofA::erm), PubMed, available at BGSC
• BKE00230 (ΔbofA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAATCTTCTCATCTCCT, downstream forward: _UP4_TAATTGATATTATGTATTGA
• BKK00230 (ΔbofA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAATCTTCTCATCTCCT, downstream forward: _UP4_TAATTGATATTATGTATTGA

References

Loading

Labs working on this gene/protein

• Simon Cutting, London, UK homepage