You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
clpP [2019-06-04 17:27:20]
ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein)
Molecular weight
21.00 kDa
Function
protein degradation
Product
ATP-dependent Clp protease proteolytic subunit
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,546,234 → 3,546,827
Phenotypes of a mutant
increased thermotolerance due to increased stabiliy of Spx and thus increased expression of trxA PubMedthe mutation suppresses the heat sensitivity of spores overexpressing cmpA PubMednon-motile PubMed The protein
Catalyzed reaction/ biological activity
Hydrolysis of proteins to small peptides in the presence of ATP and magnesium (according to Swiss-Prot) endopeptidase/proteolysisProtein family
ClpX chaperone family (with ClpP, according to UniProt) Modification
phosphorylated on Arg-13 PubMed Effectors of protein activity
the novel antibiotic ADEP (acyldepsipeptides) dysregulates ClpP activity and allows FtsZ degradation in the absence of an ATPase subunit (ClpC, ClpE, or ClpX) PubMed Structure
Localization
cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with ClpX, ClpC and ClpE PubMed Additional information
Expression and Regulation
Biological materials
Mutant
clpP::spec and clpP::cat, available in the Leendert Hamoen labBP99 (clpP::tet), available in Fabian Commichau's lab PubMedGP551 (spc), available in Jörg Stülke's labQB4916 (spc), available in Ulf Gerths's and Jörg Stülke's labs1S139 (clpP::erm), available at BGSC1S140 ( clpP::spec), available at BGSCBKE34540 (clpP::erm, available in the BGSC and in Jörg Stülke's lab) PubMedGP1822 and GP1786 (clpP::erm, available in Jörg Stülke's lab)GPUG1 (erm), available in Ulf Gerth's and Jörg Stülke's labsBKE34540 (ΔclpP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGABKK34540 (ΔclpP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA GFP fusion
C-terminal GFP fusions (both single copy and as 2th copy in amyE locus, also as CFP and YFP variants) available in the Leendert Hamoen lab Antibody
Labs working on this gene/protein
References
Reviews
Loading
Original Publications
Loading