clpP [2019-06-04 17:27:32]

ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein)

Locus: BSU34540

Isoelectric point: 5.00

Molecular weight: 21.00 kDa

Protein length: 197 aa

Gene length: 594 bp

Function: protein degradation

Product: ATP-dependent Clp protease proteolytic subunit

Essential: no

E.C.: 3.4.21.92

Synonyms: yvdN

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Proteolysis → Additional proteins involved in proteolysis
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 3,546,234 → 3,546,827

Phenotypes of a mutant

• increased thermotolerance due to increased stabiliy of Spx and thus increased expression of trxA PubMed
• the mutation suppresses the heat sensitivity of spores overexpressing cmpA PubMed
• non-motile PubMed

The protein

Catalyzed reaction/ biological activity

• Hydrolysis of proteins to small peptides in the presence of ATP and magnesium (according to Swiss-Prot) endopeptidase/proteolysis

Protein family

• ClpX chaperone family (with ClpX, according to UniProt)

Modification

• phosphorylated on Arg-13 PubMed

Effectors of protein activity

• the novel antibiotic ADEP (acyldepsipeptides) dysregulates ClpP activity and allows FtsZ degradation in the absence of an ATPase subunit (ClpC, ClpE, or ClpX) PubMed

Structure

• 3KTG PubMed

Localization

• cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with ClpX, ClpC and ClpE PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: clpP
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed, in SigB regulon

  Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon

  Regulation

  • induced by heat (CtsR) PubMed

Biological materials

Mutant

• clpP::spec and clpP::cat, available in the Leendert Hamoen lab
• BP99 (clpP::tet), available in Fabian Commichau's lab PubMed
• GP551 (spc), available in Jörg Stülke's lab
• QB4916 (spc), available in Ulf Gerths's and Jörg Stülke's labs
• 1S139 (clpP::erm), available at BGSC
• 1S140 ( clpP::spec), available at BGSC
• BKE34540 (clpP::erm, available in the BGSC and in Jörg Stülke's lab) PubMed
• GP1822 and GP1786 (clpP::erm, available in Jörg Stülke's lab)
• GPUG1 (erm), available in Ulf Gerth's and Jörg Stülke's labs
• BKE34540 (ΔclpP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
• BKK34540 (ΔclpP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA

GFP fusion

• C-terminal GFP fusions (both single copy and as 2th copy in amyE locus, also as CFP and YFP variants) available in the Leendert Hamoen lab

Antibody

• available in Ulf Gerth's and Jörg Stülke's labs

Labs working on this gene/protein

• Leendert Hamoen, Newcastle University, UK homepage

References

Reviews

Loading

Original Publications

Loading