rapK

response regulator aspartate phosphatase, controls ComA activity

Locus: BSU_18910

Isoelectric point: 5.06

Molecular weight: 43.68 kDa

Protein length: 371 aa

Gene length: 1116 bp

Function: control of ComA activity

Product: response regulator aspartate phosphatase

Essential: no

Synonyms: yobG

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → Genetic competence
• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein phosphatases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Response regulator aspartate phosphatase
• Information processing → Regulation of gene expression → Quorum sensing
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence

Gene

Coordinates: 2,062,150 → 2,063,265

The protein

Catalyzed reaction/ biological activity

• control of ComA activity PubMed

Protein family

• RAP family (according to UniProt)

Domains

• six tetratrichopeptide repeats (according to UniProt)

Effectors of protein activity

• binding of PhrK inhibits RapK activity PubMed

Structure

• 4I1A (RapI, 30% identity) PubMed

Expression and Regulation

Operons

• Genes: rapK-phrK
  Description: PubMed

  Sigma factors

  • SigH: sigma factor, PubMed, in SigH regulon

  Regulatory mechanism

  • PhoP: activation, PubMed, in PhoP regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • induced under conditions of phosphate limitation (PhoP) PubMed

Biological materials

Mutant

• BKE18910 (ΔrapK::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG, downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT
• BKK18910 (ΔrapK::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG, downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT

References

Loading