wapI

immunity protein, protects the cell against the toxic activity of WapA

Locus: BSU_39220

Isoelectric point: 4.42

Molecular weight: 16.29 kDa

Protein length: 142 aa

Gene length: 429 bp

Function: intercellular competition

Product: immunity protein

Essential: yes

Synonyms: yxxG

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Coping with stress → Toxins, antitoxins and immunity against toxins/ based on similarity
• Groups of genes → Essential genes
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 4,023,054 → 4,023,482

Phenotypes of a mutant

• essential PubMed
• severe growth defect PubMed

The protein

Catalyzed reaction/ biological activity

• WapI inhibits the toxic activity of WapA PubMed

Modification

• phosphorylation on (Tyr-102 OR Ser-105) PubMed

Expression and Regulation

Operons

• Genes: wapA-wapI
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • DegU: repression, DegU-P, PubMed, in DegU regulon
  • YvrHb: activation, PubMed, in YvrHb regulon
  • WalR: repression, PubMed, in WalR regulon

  Regulation

  • repressed at high salt concentration (DegU-P) PubMed

  Additional information

  • PhoP∼P binds to the promoter region, but regulation has not been explored PubMed

Biological materials

Mutant

• MGNA-B789 (yxxG::erm), available at the NBRP B. subtilis, Japan
• BKE39220 (ΔwapI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTCCTCCTCATTTAA, downstream forward: _UP4_TAATTATAAATAATTTCTGC
• BKK39220 (ΔwapI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTCCTCCTCATTTAA, downstream forward: _UP4_TAATTATAAATAATTTCTGC

References

Loading