You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yuiE [2020-09-22 10:20:22]
similar to leucyl aminopeptidase
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]Gene
Coordinates
3,296,417 → 3,297,919
The protein
Catalyzed reaction/ biological activity
Release of an N-terminal amino acid, Xaa-|-Yaa-, in which Xaa is preferably Leu, but may be other amino acids including Pro although not Arg or Lys, and Yaa may be Pro. Amino acid amides and methyl esters are also readily hydrolyzed, but rates on arylamides are exceedingly low (according to UniProt)Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)Protein family
peptidase M17 family (single member, according to UniProt)Structure
[PDB|3H8E] (from Pseudomonas putida 37% identity) [pubmed|20359484]Expression and Regulation
Operons
genes
[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]
description
[Pubmed|22383849]
view in new tabBiological materials
Mutant
MGNA-B569 (yuiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1568 NBRP B. subtilis, Japan]BKE32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGTBKK32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGTReferences