You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
dgcK [2020-03-12 12:03:47]
Molecular weight
40.53 kDa
Function
synthesis of c-di-GMP
Product
diguanylate cyclase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
985,734 → 986,813
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-GMP from two molecules of GTP PubMed Domains
six transmembrane helices at the N-terminus (according to UniProt?)contains a C-terminal GGDEF domain PubMedGGDEF domain (aa 223-357) (according to UniProt) Structure
2WB4 (the C-terminal GGDEF domain, PleD from Caulobacter vibrioides, 44% identity) Localization
cell membrane at cell poles and septa, probably close to YdaK PubMedpresent at a single site in the cell membrane PubMed Additional information
DgcK is present with about 6 molecules per cell PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A656 (yhcK::erm), available at the NBRP B. subtilis, JapanGP848 (dgcK::ermC), available in Jörg Stülke's lab PubMedBKE09120 (ΔdgcK::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTCBKK09120 (ΔdgcK::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC References
Loading