You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
gudB
glutamate dehydrogenase, trigger enzyme
Molecular weight
47.05 kDa
Function
glutamate utilization, control of
GltC activity
Product
glutamate dehydrogenase, trigger enzyme
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,402,067 → 2,403,350
Phenotypes of a mutant
The gene is cryptic. If gudB is activated (gudB1 mutation), the bacteria are able to utilize glutamate as the only carbon source. PubMedA rocG gudB mutant is sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin due to the downregulation of the SigW regulon PubMedtranscription profile of a rocG gudB mutant strain: GEO PubMed The protein
Catalyzed reaction/ biological activity
H2O + L-glutamate + NAD+ --> 2-oxoglutarate + H+ + NADH + NH4+ (according to UniProt)Protein family
Glu/Leu/Phe/Val dehydrogenases family (with Bcd and RocG, according to UniProt) Paralogous protein(s)
Modification
phosphorylated on Arg-56, Arg-83, and Arg-421 and/or Arg-423 PubMed Cofactors
NAD+/NADH + H+Structure
Additional information
GudB is subject to Clp-dependent proteolysis upon glucose starvation PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A397 (ypcA::erm), available at the NBRP B. subtilis, JapanGP691 (ΔgudB::cat), GP1160 (ΔgudB::aphA3) both available in Jörg Stülke's labBKE22960 (ΔgudB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAABKK22960 (ΔgudB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAAGP2834 (gudB++), available in Jörg Stülke's lab Expression vectors
for purification of GudB from E. coli carrying an N-terminal Strep-tag: pGP863 (in pGP172) available in Jörg Stülke's labfor purification of GudB1 from E. coli carrying an N-terminal Strep-tag: pGP864 (in pGP172) available in Jörg Stülke's labfor ectopic expression of gudB with its native promoter: pGP900 (in pAC5), available in Jörg Stülke's labwild type gudB, expression in B. subtilis, in pBQ200: pGP1712, available in Jörg Stülke's labpBP179 (N-terminal Strep-tag gudB+, purification from B. subtilis, for SPINE, in pGP380), available in Fabian Commichau's lab LacZ fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab FLAG-tag construct
Antibody
Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading