ycgT [2018-02-10T09:46:49.000Z]

NADPH:ferredoxin oxidoreductase

locus: BSU03270

pI: 5.61

mw: 36.81 kDa

protein length: 336 aa

gene length: 1008 bp

function: unknown

product: NADPH:ferredoxin oxidoreductase

essential: no

synonyms

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]

Gene

Coordinates: 352,858 → 353,868

The protein

Catalyzed reaction/ biological activity

• 2 reduced ferredoxin NADP H = 2 oxidized ferredoxin NADPH (according to Swiss-Prot)

Protein family

• ferredoxin--NADP reductase type 2 family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|BAA74A6971CED9FB55540F1BC602CDA287D83E74|YumC]

[SW|Cofactors]

• FAD [Pubmed|25826316]

Structure

• [PDB|3LZW] ([protein|BAA74A6971CED9FB55540F1BC602CDA287D83E74|YumC], 49% identity) [pubmed|20878669]

Additional information

• The gene is annotated in KEGG as an ortholog of thioredoxin reductase (NADPH) EC 1.8.1.9. In MetaCyc the protein is marked as “similar to thioredoxin
• reductase”. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]

Expression and Regulation

Operons

• genes: [gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]
  description: [pubmed|22383849]

  regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]

  regulation

  • induced under conditions of iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|16672620]

  additional information

  • the mRNA is very stable (half-life > 15 min) [Pubmed|12884008]

Biological materials

Mutant

• MGNA-C052 (ycgT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2050 NBRP B. subtilis, Japan]
• GP1852 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::cat), available in [SW|Jörg Stülke]'s lab
• BKE03270 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCCTGCCTCCCGTT, downstream forward: _UP4_TAAAACAGCCCTTGAGGAAA
• BKK03270 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCCTGCCTCCCGTT, downstream forward: _UP4_TAAAACAGCCCTTGAGGAAA

References

• 12884008,16672620,25826316,20878669