You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
minJ [2019-07-12 09:36:14]
topological determinant of
cell division, part of the Min system (with Z ring placement)
Molecular weight
43.51 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,620,346 → 3,621,539
Phenotypes of a mutant
inactivation of minJ reduces sporulation efficiency to 36% that of wild type cells; delayed entry into sporulation and aberrant forespores PubMed The protein
Catalyzed reaction/ biological activity
The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle PubMedrequired for oriC placement during spore development PubMed Domains
7 transmembrane helices (aa 15- 269) (according to UniProt)PDZ domain (aa 295 - 361) (according to UniProt) Localization
forms rings at the division septum PubMedcell membrane PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B648 (minJ::erm), available at the NBRP B. subtilis, JapanBKE35220 (ΔminJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCGBKK35220 (ΔminJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab Labs working on this gene/protein
References
Reviews
Loading
Original Publications
Loading