minJ

topological determinant of cell division, part of the Min system (with Z ring placement)

Locus: BSU_35220

Isoelectric point: 9.06

Molecular weight: 43.51 kDa

Protein length: 397 aa

Gene length: 1194 bp

Function: cell division site selection

Product: topological determinant of cell division

Essential: no

Synonyms: yvjD,swrAB

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → The Min system
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,620,346 → 3,621,539

Phenotypes of a mutant

• inactivation of minJ reduces sporulation efficiency to 36% that of wild type cells; delayed entry into sporulation and aberrant forespores PubMed

The protein

Catalyzed reaction/ biological activity

• The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle PubMed
• required for oriC placement during spore development PubMed

Protein family

• MinJ family (single member, according to UniProt)

Domains

• 7 transmembrane helices (aa 15- 269) (according to UniProt)
• PDZ domain (aa 295 - 361) (according to UniProt)

Localization

• forms rings at the division septum PubMed
• cell membrane PubMed

Expression and Regulation

Operons

• Genes: swrAA/2-minJ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • DegU: activation, DegU-P, (SigA promoter) PubMed, in DegU regulon

• Genes: minJ
  Description: PubMed

Biological materials

Mutant

• MGNA-B648 (minJ::erm), available at the NBRP B. subtilis, Japan
• BKE35220 (ΔminJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
• BKK35220 (ΔminJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Daniel Kearns, Indiana University, Bloomington, USA, homepage
• Marc Bramkamp, University of Cologne, Cologne, Germany homepage

References

Reviews

Loading

Original Publications

Loading