gpsB

cell cycle regulator, cytosolic adaptor for multiple cell wall enzymes, required for removal of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1] from the cell pole after completion of cell pole maturation

locus: BSU_22180

pI: 5.63

mw: 11.45 kDa

protein length: 98 aa

gene length: 297 bp

function: [SW|cell division], cell elongation, spatiotemporal control of penicillin‐binding protein activity

product: [protein|search|cell division] adaptor protein, member of the [SW|divisome]

essential: no

synonyms: ypsB

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]

Gene

Coordinates: 2,331,779 → 2,332,075

Phenotypes of a mutant

• synthetic lethal phenotype with a ''[gene|672EA84D7725BE21F649DF30A11EB4E0EDFC3925|ftsA]'' mutation [Pubmed|18776011]; synthetic sick phenotype when combined with an ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' mutation [Pubmed|18363795], although this seems controversial [Pubmed|18776011]
• reduced growth at high salt [Pubmed|25845974]

The protein

Catalyzed reaction/ biological activity

• activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|25845974]

Protein family

• GpsB family (single member, according to UniProt)

Paralogous protein(s)

• [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|DivIVA]

[SW|Domains]

• contains a [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|DivIVA]-like N-terminal lipid binding domain [pubmed|30887576]

Modification

• phosphorylation on Thr-75 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|25845974,17218307]

Structure

• [PDB|4UG3] (N-terminal domain, aa 1-68) [Pubmed|26575090]
• [PDB|5AN5] (C-terminal domain, aa 76-98) [Pubmed|26575090]
• GpsB is hexameric (trimer of dimers) [Pubmed|26575090]
• [PDB|6GP7] (Complexed with peptide fragment of PBP1A) [Pubmed|30651563]
• [PDB|6GPZ] (Complexed with peptide fragment of L. monocytogenes PBP1A) [Pubmed|30651563]

[SW|Localization]

• dynamic, shuttles between lateral membrane and the divison septum [Pubmed|18363795], localizes to the divisome after Z-ring formation [Pubmed|18776011]

Expression and Regulation

Operons

• genes: [gene|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|gpsB]-[gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB]-[gene|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|ypsC]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-A472 (gpsB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/472 NBRP B. subtilis, Japan]
• 1A934 ( ''gpsB''::''kan''), [Pubmed|18776011], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A934&Search=1A934 BGSC]
• 1A970 ( ''gpsB''::''kan''), [Pubmed|18776011], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A970&Search=1A970 BGSC]
• BKE22180 (Δ[gene|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|gpsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCGTATC, downstream forward: _UP4_TGATCACGCTTGAAAAAAAT
• BKK22180 (Δ[gene|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|gpsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCGTATC, downstream forward: _UP4_TGATCACGCTTGAAAAAAAT

GFP fusion

• [Pubmed|18363795,18776011]

two-hybrid system

• [Pubmed|18363795]

Antibody

• raised against L. monocytogenes GpsB [Pubmed|26575090] available in [SW|Sven Halbedel] 's lab

References

Reviews

• 30887576,31405912

Original Publications

• 18776011,25845974,19429628,17218307,18363795,26575090,27257764,30277210,30651563,32630428