araN [2019-01-04 16:00:51]

ABC transporter for the uptake of α-1,5-arabinooligosaccharides, at least up to four L-arabinosyl units (sugar-binding protein)

Locus: BSU28750

Isoelectric point: 8.56

Molecular weight: 48.48 kDa

Protein length: 433 aa

Gene length: 1299 bp

Function: uptake of α-1,5-arabinooligosaccharides

Product: α-1,5-arabinooligosaccharide ABC transporter (sugar-binding protein))

Essential: no

Synonyms: yseC

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of arabinan/ arabinose/ arabitol
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,941,674 → 2,942,975

The protein

Protein family

• bacterial solute-binding protein 1 family (according to Swiss-Prot)

Structure

• 5YSB (28% identity)

Localization

• cell membrane (via AraP-AraQ) PubMed

Expression and Regulation

Operons

• Genes: araA-araB-araD-araL-araM-araN-araP-araQ-abfA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, PubMed, in CcpA regulon
  • AraR: repression, PubMed, in AraR regulon

  Regulation

  • induced by arabinose (AraR) PubMed

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• MGNA-B004 (araN::erm), available at the NBRP B. subtilis, Japan
• BKE28750 (ΔaraN::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGCGTTACCCCTTCCA, downstream forward: _UP4_TAGAATCCCATTCAAAAAGT
• BKK28750 (ΔaraN::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGCGTTACCCCTTCCA, downstream forward: _UP4_TAGAATCCCATTCAAAAAGT

References

Loading