yclQ [2017-11-16 13:28:02]

petrobactin (3.4-catecholate siderophore) ABC transporter (binding protein), major component of the secretome

Locus: BSU03830

Isoelectric point: 6.63

Molecular weight: 34.64 kDa

Protein length: 317 aa

Gene length: 951 bp

Function: acquisition of iron

Product: petrobactin ABC transporter (binding protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of iron/ siderophores
• Cellular processes → Homeostasis → Acquisition of iron → ABC transporters for the uptake of iron/ siderophores
• Metabolism → Additional metabolic pathways → Iron metabolism → ABC transporters for the uptake of iron/ siderophores
• Groups of genes → Secreted proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 435,036 → 435,989

The protein

Catalyzed reaction/ biological activity

• uptake of the siderophore petrobactin PubMed

Protein family

• Fe/B12 periplasmic-binding domain (according to Swiss-Prot)

Structure

• 3GFV

Localization

• associated to the membrane (via FpbN-FpbO) PubMed
• extracellular (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: fpbN-fpbO-fpbP-fpbQ
  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) (Fur) PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-C067 (yclQ::erm), available at the NBRP B. subtilis, Japan
• BKE03830 (ΔfpbQ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTCCTCACCTCTTCTA, downstream forward: _UP4_TAAAACCAAAAAGAGCCTCC
• BKK03830 (ΔfpbQ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTCCTCACCTCTTCTA, downstream forward: _UP4_TAAAACCAAAAAGAGCCTCC

References

Loading

Synonyms: fpiA