slrA

negative regulator of the fla-che operon, anti-repressor, antagonist SinR for the repression of the epsA→epsO and tapA-sipW-tasA operons

Locus: BSU_38229

Isoelectric point: 9.00

Molecular weight: 6.00 kDa

Protein length: 52 aa

Gene length: 159 bp

Function: control of motility and biofilm formation

Product: antagonist of SinR and SlrR

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → Transition state regulators
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming

Gene

Coordinates: 3,923,319 → 3,923,477

RNA

Additional information

• the mRNA has long 5' and 3' UTRs (170 and 330 nt, respectively) PubMed

The protein

Catalyzed reaction/ biological activity

• binding of SinR resulting in induction of SinR-repressed genes and operons PubMed

Paralogous protein(s)

• SinI

Domains

• Sin domain (aa 1-38) (according to UniProt)

Effectors of protein activity

• SlrR inhibits activity of SlrA (i. e. binding to SinR) PubMed

Expression and Regulation

Operons

• Genes: slrA
  Description: PubMed

  Regulatory mechanism

  • YwcC: repression, PubMed, in YwcC regulon

  Additional information

  • increased expression in a pnpA mutant PubMed
  • half-life of the mRNA: 0.56 min, this increases to 1.06 in a pnpA mutant PubMed
  • RNA degradation by PnpA is proceeds from the 3' end of the mRNA through the Rho-dependent terminator PubMed
  • transcription termination depends on Rho PubMed

Biological materials

Mutant

• BKE38229 (ΔslrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
• BKK38229 (ΔslrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Stülke lab

References

Loading