citM [2019-03-25 12:09:51]

Mg²⁺-citrate transporter

Locus: BSU07610

Isoelectric point: 6.23

Molecular weight: 45.67 kDa

Protein length: 433 aa

Gene length: 1302 bp

Function: uptake of citrate and magnesium

Product: Mg²⁺-citrate transporter

Essential: no

Synonyms: yflO

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Transporter for organic acids
• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Magnesium uptake/ efflux
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of organic acids
• Groups of genes → Membrane proteins

Gene

Coordinates: 834,383 → 835,684

Phenotypes of a mutant

• no growth with citrate as sole carbon source PubMed

The protein

Protein family

• CitM transporter family (TC 2.A.11) (according to UniProt)

Paralogous protein(s)

• CitH

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: citM-yflN
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CitT: activation, PubMed, in CitT regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • induced by citrate (CitT) PubMed

Biological materials

Mutant

• MGNA-C252 (citM::erm), available at the NBRP B. subtilis, Japan
• GP2244 (citM::ermC), available in Jörg Stülke's lab
• GP2760 (citM::kan), available in Jörg Stülke's lab
• GP2761 (citM::spec), available in Jörg Stülke's lab
• BKE07610 (ΔcitM::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATCCATTCCCCCTTAAA, downstream forward: _UP4_TGATAATTCAGGCGTAATGA
• BKK07610 (ΔcitM::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATCCATTCCCCCTTAAA, downstream forward: _UP4_TGATAATTCAGGCGTAATGA

References

Loading