tasA [2019-08-05 08:35:43]

major component of biofilm matrix, forms amyloid fibers

Locus: BSU_24620

Isoelectric point: 5.44

Molecular weight: 28.15 kDa

Protein length: 261 aa

Gene length: 786 bp

Function: biofilm formation

Product: major component of biofilm matrix

Essential: no

Synonyms: cotN,yqhF

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Amyloid protein synthesis, secretion and assembly
• Groups of genes → Secreted proteins

Gene

Coordinates: 2,553,081 → 2,553,866

Phenotypes of a mutant

• altered cell death pattern in colonies PubMed

The protein

Catalyzed reaction/ biological activity

• forms amyloid fibers that bind cells together in the biofilm PubMed

Protein family

• peptidase M73 family (single member, according to UniProt)

Structure

• 5OF1 PubMed
• 5OF2 PubMed

Localization

• extracellular (signal peptide) PubMed, secretion requires SipW PubMed

Expression and Regulation

Operons

• Genes: tapA-sipW-tasA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: repression, PubMed, in SinR regulon
  • RemA: activation, PubMed, in RemA regulon
  • LutR: activation, PubMed, in LutR regulon

  Regulation

  • repressed by casamino acids PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed or by SlrR PubMed
  • expression of the operon is localized to a ring near the periphery of the biofilm PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-C449 (yqhF::erm), available at the NBRP B. subtilis, Japan
• BKE24620 (ΔtasA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
• BKK24620 (ΔtasA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA

References

Reviews

Loading

Original publications

Loading