yocH [2019-12-09 11:59:56]

peptidoglycan hydrolase (amidase)

Locus: BSU_19210

Isoelectric point: 8.37

Molecular weight: 30.03 kDa

Protein length: 287 aa

Gene length: 864 bp

Function: cell wall turnover

Product: peptidoglycan hydrolase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Autolysis
• Groups of genes → Secreted proteins

Gene

Coordinates: 2,092,899 → 2,093,762

The protein

Domains

• contains two N-acetylglucosamine-polymer-binding LysM domains PubMed
• 2 LysM domains (aa 26-69, aa 78-121) (according to UniProt)

Localization

• extracellular (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: yocH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • WalR: activation, PubMed, in WalR regulon

  Regulation

  • expression is modulated in response to D,L-endopeptidase activity (increased upon reduced activity in the absence of CwlO or FtsE-FtsX, decreased upon overexpression of LytE) (WalR) PubMed
  • expressed under conditions that trigger sporulation (Spo0A) PubMed

• Genes: bsrB-recQ-yocH
  Description: PubMed

Biological materials

Mutant

• MGNA-A321 (yocH::erm), available at the NBRP B. subtilis, Japan
• AH023 knock-out mutant (kan), available in Kevin Devine's and Jörg Stülke's labs PubMed
• BKE19210 (yocH::erm, available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE19210 (ΔyocH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA
• BKK19210 (ΔyocH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA

Expression vectors

• pGP1691, expression of yocH-Strep in B. subtilis, in pGP382, available in Jörg Stülke's lab
• pGP1693, expression of yocH-Strep in E. coli, in pGP574, available in Jörg Stülke's lab

Labs working on this gene/protein

• Kevin Devine

References

Reviews

Loading

Original publications

Loading