yfhO

required for lipoteichoic acid glycosylation

locus: BSU_08610

pI: 9.63

mw: 93.56 kDa

protein length: 861 aa

gene length: 2586 bp

function: lipoteichoic acid glycosylation

product: glycosyltransferase

essential: no

synonyms

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
• [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 931,879 → 934,464

Phenotypes of a mutant

• expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|YfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] [Pubmed|23632331]

The protein

Catalyzed reaction/ biological activity

• moves GlcNAc sugar moieties from a C55-P intermediate onto the lipoteichoic acid backbone on the outside of the cell [pubmed|29343515]

[SW|Domains]

• 13 predicted transmembrane helices and a large extracellular loop of 389 amino acids connecting the last two transmembrane helices [pubmed|29343515]

[SW|Localization]

• cell membrane, with large extracellular loop [pubmed|29343515]

Expression and Regulation

Operons

• genes: [gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]-[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]
  description: [Pubmed|22383849,8921856]

  sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8921856,9636707], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]

  regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|8921856,15805528,9636707]

Biological materials

Mutant

• MGNA-C320 (yfhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2318 NBRP B. subtilis, Japan]
• BKE08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
• BKK08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC

References

• 23632331,29343515