yfhO

required for lipoteichoic acid glycosylation

Locus: BSU_08610

Isoelectric point: 9.63

Molecular weight: 93.56 kDa

Protein length: 861 aa

Gene length: 2586 bp

Function: lipoteichoic acid glycosylation

Product: glycosyltransferase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of lipoteichoic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of lipoteichoic acid
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 931,879 → 934,464

Phenotypes of a mutant

• expression of CsbB in the absence of YfhO causes constitutive activation of SigM PubMed

The protein

Catalyzed reaction/ biological activity

• moves GlcNAc sugar moieties from a C55-P intermediate onto the lipoteichoic acid backbone on the outside of the cell PubMed

Domains

• 13 predicted transmembrane helices and a large extracellular loop of 389 amino acids connecting the last two transmembrane helices PubMed

Localization

• cell membrane, with large extracellular loop PubMed

Expression and Regulation

Operons

• Genes: csbB-yfhO
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon
  • SigX: sigma factor, PubMed, in SigX regulon

  Regulation

  • induced by stress (SigB) PubMed

Biological materials

Mutant

• MGNA-C320 (yfhO::erm), available at the NBRP B. subtilis, Japan
• BKE08610 (ΔyfhO::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
• BKK08610 (ΔyfhO::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC

References

Loading