cwlQ [2020-04-17 17:03:49]

cell wall hydrolase

locus: BSU_11570

pI: 7.01

mw: 18.85 kDa

protein length: 181 aa

gene length: 546 bp

function: cell wall turnover

product: bifunctional enzyme with muramidase and

essential: no

synonyms: yjbJ

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,235,163 → 1,235,708

The protein

Catalyzed reaction/ biological activity

• bifunctional cell wall hydrolase with muramidase and soluble-lytic transglycosylase activities [Pubmed|20609359]

Protein family

• transglycosylase Slt family (together with [protein|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|CwlP]) (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
  description: [Pubmed|15033535]

  sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]

• genes: [gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]-[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-B156 (yjbJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1155 NBRP B. subtilis, Japan]
• BKE11570 (Δ[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGAGCGGGCTTGGCG, downstream forward: _UP4_TAACCAGAGGTGCTCTTTCC
• BKK11570 (Δ[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGAGCGGGCTTGGCG, downstream forward: _UP4_TAACCAGAGGTGCTCTTTCC

References

• 20609359,15033535