rapH

response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay, control of ComA activity

Locus: BSU_06830

Isoelectric point: 6.12

Molecular weight: 49.96 kDa

Protein length: 376 aa

Gene length: 1131 bp

Function: control of sporulation initiation and ComA activity

Product: response regulator aspartate phosphatase

Essential: no

Synonyms: yeeH,yzqA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein phosphatases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Response regulator aspartate phosphatase
• Information processing → Regulation of gene expression → phosphorelay → Phosphatases controlling the phosphorelay
• Information processing → Regulation of gene expression → Quorum sensing
• Lifestyles → Sporulation → phosphorelay → Phosphatases controlling the phosphorelay

Gene

Coordinates: 750,959 → 752,089

The protein

Catalyzed reaction/ biological activity

• binds to and thereby inhibits ComA activity PubMed
• RapH dephosphorylates Spo0F-P and thereby controls the phosphorelay PubMed
• in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F PubMed

Protein family

• RAP family (according to UniProt)

Domains

• six tetratrichopeptide repeats (according to UniProt)

Effectors of protein activity

• interaction with PhrH inhibits dephosphorylation of Spo0F and sequestration of ComA by RapH PubMed

Structure

• 3Q15 (RapH-Spo0F complex) PubMed

Expression and Regulation

Operons

• Genes: rapH-phrH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RghR: repression, PubMed, in RghR regulon
  • ComK: activation, PubMed, in ComK regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • rapH: repressed by RghR PubMed

Biological materials

Mutant

• MGNA-A013 (rapH::erm), available at the NBRP B. subtilis, Japan
• BKE06830 (ΔrapH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
• BKK06830 (ΔrapH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG

References

Loading