yjmF [2019-04-16 13:34:45]

similar to D-mannonate oxidoreductase/ fructuronate reductase

Locus: BSU12350

Isoelectric point: 5.25

Molecular weight: 29.33 kDa

Protein length: 278 aa

Gene length: 837 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: uxuB

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of hexuronate
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other

Gene

Coordinates: 1,306,562 → 1,307,398

The protein

Protein family

• short-chain dehydrogenases/reductases (SDR) family (according to Swiss-Prot)

Structure

• 4WUV (the enzyme from Haemophilus influenzae, 48% identity, 81% similarity)

Expression and Regulation

Operons

• Genes: yjmC-yjmD-uxuA-yjmF-exuT-exuR-uxaB-uxaA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigE: sigma factor, PubMed, in SigE regulon

  Regulatory mechanism

  • ExuR: repression, in the absence of inducer, in ExuR regulon
  • CcpA: repression, PubMed PubMed, in CcpA regulon

  Regulation

  • induced by galacturonate (ExuR) PubMed

• Genes: uxaC-yjmB-yjmC-yjmD-uxuA-yjmF-exuT-exuR-uxaB-uxaA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • ExuR: repression, in the absence of inducer, in ExuR regulon
  • CcpA: repression, PubMed PubMed, in CcpA regulon

  Regulation

  • induced by galacturonate (ExuR) PubMed

Biological materials

Mutant

• MGNA-A370 (yjmF::erm), available at the NBRP B. subtilis, Japan
• BKE12350 (ΔyjmF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGCCAGGTTCTCATGCAGCG, downstream forward: _UP4_TAACGAAAGCGGTGCAACAG
• BKK12350 (ΔyjmF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGCCAGGTTCTCATGCAGCG, downstream forward: _UP4_TAACGAAAGCGGTGCAACAG

References

Loading