rex

transcriptional repressor of anaerobically expressed genes involved in anaerobic respiration and fermentation

Locus: BSU_05970

Isoelectric point: 6.77

Molecular weight: 23.95 kDa

Protein length: 215 aa

Gene length: 648 bp

Function: regulation of fermentation and anaerobic respiration

Product: transcriptional repressor

Essential: no

Synonyms: ydiH

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → Regulators of electron transport
• Metabolism → Carbon metabolism → Carbon core metabolism → Overflow metabolism
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 647,091 → 647,738

Phenotypes of a mutant

• inactivation of rex reduces sporulation efficiency to 9.2% that of wild type cells PubMed
• inactivation of rex confers resistance to high concentrations of Zn(II) PubMed

The protein

Protein family

• transcriptional regulatory rex family (single member, according to UniProt)

Effectors of protein activity

• NADH (indication of low oxygen concentration) releases Rex from DNA PubMed, Rex has a very high affinity for NADH

Structure

• 2VT2, 2VT3

Localization

• cytoplasm (according to Swiss-Prot)

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: ydiG-rex-tatAY-tatCY
  Description: PubMed

  Regulation

  • constitutitvely expressed PubMed
  • the mRNA is processed between rex and tatAY by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

Biological materials

Mutant

• MGNA-C201 (ydiH::erm), available at the NBRP B. subtilis, Japan
• LUW292 (erm), GP834 (erm), both available in the Stülke lab
• BKE05970 (Δrex::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CGGAATTTTTGATTGATCCT, downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC
• BKK05970 (Δrex::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CGGAATTTTTGATTGATCCT, downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC

Labs working on this gene/protein

• Claes von Wachenfeldt, Lund University, Sweden Homepage

References

Reviews

Loading

Original publications

Loading