ptsG [2019-08-26 11:27:06]

glucose permease of the phosphotransferase system, EIICBA of the PTS, Trigger enzyme, control of GlcT activity

Locus: BSU_13890

Isoelectric point: 5.41

Molecular weight: 75.34 kDa

Protein length: 699 aa

Gene length: 2100 bp

Function: glucose transport and phosphorylation, control of GlcT activity

Product: glucose permease, trigger enzyme

Essential: no

E.C.: 2.7.1.69

Synonyms: ptsX,crr

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Phosphotransferase system → Sugar specific PTS proteins
• Metabolism → Carbon metabolism → Carbon core metabolism → Glycolysis
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of PRD-type regulators
• Information processing → Regulation of gene expression → Trigger enzyme → Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a Cys residue
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 1,457,187 → 1,459,286

The protein

Catalyzed reaction/ biological activity

• transport and phosphorylation of glucose, receives a phosphate from HPr]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator GlcT.
• D-glucose + N^π-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)

Protein family

• PTS permease, glucose family PubMed

Domains

• 11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
• PTS EIIC domain ( 1-424)
• PTS EIIB domain (439–520)
• PTS EIIA domain (568–672)

Modification

• transient phosphorylation (HPr]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461

Structure

• 5IWS (the IIC domain of B. cereus MalT, 32% identity) PubMed
• 1AX3 (IIA domain) PubMed
• 1GPR (IIA domain)

Localization

• membrane protein PubMed

Expression and Regulation

Operons

• Genes: ptsG-ptsH-ptsI
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in GlcT regulon

  Regulation

  • expression activated by glucose (2 fold) (GlcT) PubMed

Biological materials

Mutant

• GP778 (ΔglcT-ptsG-ptsH-ptsI::spc) PubMed, available in Jörg Stülke's lab
• BKE13890 (ΔptsG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
• BKK13890 (ΔptsG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Expression vectors

• pGP123 (domains BA, in pWH844), available in Jörg Stülke's lab
• pGP141 (domains BA, mut: H620D, in pWH844), available in Jörg Stülke's lab
• pGP428 (EIIB, in pWH844), available in Jörg Stülke's lab
• pGP437(EIIA in pGP570, with thrombin cleavage site), available in Jörg Stülke's lab

LacZ fusion

• pGP34 (pAC5) PubMed, available in Jörg Stülke's lab
• pGP66 (pAC7) PubMed, available in Jörg Stülke's lab
• pGP606 (mutant terminator, pAC6), available in Jörg Stülke's lab
• pGP532 (pAC7), available in Jörg Stülke's lab
• series of promoter deletions are available in pAC5 and pAC6, available in Jörg Stülke's lab
• series of RAT mutants are available in pAC6, available in Jörg Stülke's lab

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original publications

Loading