function
glucose transport and phosphorylation, control of [protein|search|GlcT ]activity
Genomic Context
categories
[category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins][category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]Gene
Coordinates
1,457,187 → 1,459,286
The protein
Catalyzed reaction/ biological activity
transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT].Protein family
[protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, glucose permease (Glc) family [Pubmed|10627040], [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] enzyme II[SW|Domains]
11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)PTS EIIC domain ( 1-424)PTS EIIB domain (439–520)PTS EIIA domain (568–672)Modification
transient phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461Structure
[PDB|5IWS] (the IIC domain of B. cereus MalT, 32% identity) [pubmed|27161976][PDB|1AX3] (IIA domain)[PDB|1GPR] (IIA domain)[SW|Localization]
membrane protein [Pubmed|18763711]Expression and Regulation
Operons
genes
[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
description
[Pubmed|11902727]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response][protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]regulation
expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]view in new tabBiological materials
Mutant
BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGTBKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGTExpression vector
pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s labpGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s labpGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s labpGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lablacZ fusion
pGP34 ([protein|search|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s labpGP66 ([protein|search|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s labpGP606 (mutant terminator, [protein|search|pAC6]), available in [SW|Jörg Stülke]'s labpGP532 ([protein|search|pAC7]), available in [SW| Jörg Stülke]'s labseries of promoter deletions are available in [protein|search|pAC5] and [protein|search|pAC6], available in [SW|Jörg Stülke]'s labseries of RAT mutants are available in [protein|search|pAC6], available in [SW|Jörg Stülke]'s labLabs working on this gene/protein
[SW|Jörg Stülke], University of Göttingen, Germany[http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]References
Reviews
Original publications
10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219,27161976