ykoV [2019-04-17 09:27:21]

DNA-end-binding protein Ku, non-homologous end joining DNA repair

Locus: BSU13410

Isoelectric point: 7.21

Molecular weight: 34.91 kDa

Protein length: 311 aa

Gene length: 936 bp

Function: non-homologous end joining DNA repair, repair of gapped DNA substrates

Product: DNA-end-binding protein Ku

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination
• Information processing → Genetics → DNA repair/ recombination → Spore-encoded non-homologous end joining system
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other

Gene

Coordinates: 1,406,357 → 1,407,292

Phenotypes of a mutant

• sensitivity to ionizing radiation in the stationary phase PubMed
• sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat PubMed
• a ykoV-ligD double mutant is sensitive to radiation PubMed

The protein

Catalyzed reaction/ biological activity

• stimulation of LigD non-homologous end-joining activity PubMed
• binds at the DNA double-strand breaks and recruits the ligase LigD to seal the break PubMed

Localization

• associates with the nucleoid during germination PubMed

Expression and Regulation

Operons

• Genes: ykoV-ligD
  Description: PubMed

  Sigma factors

  • SigG: sigma factor, PubMed, in SigG regulon

  Regulatory mechanism

  • SpoVT: activation, PubMed, in SpoVT regulon

  Regulation

  • expressed during sporulation in the forespore (SigG, SpoVT) PubMed

Biological materials

Mutant

• MGNA-A779 (ykoV::erm), available at the NBRP B. subtilis, Japan
• BP141 (ykoV-ligD::kan) available in Fabian Commichau's lab
• BP142 (dgcW-ykoV-ligD::kan) available in Fabian Commichau's lab
• BKE13410 (ΔykoV::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGTAGTAACTTATGGG, downstream forward: _UP4_AAAGCCTCCGGCACATCATA
• BKK13410 (ΔykoV::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGTAGTAACTTATGGG, downstream forward: _UP4_AAAGCCTCCGGCACATCATA

References

Reviews

Loading

Original publications

Loading