ezrA

negative regulator of FtsZ ring formation

Locus: BSU_29610

Isoelectric point: 4.76

Molecular weight: 64.82 kDa

Protein length: 562 aa

Gene length: 1689 bp

Function: control of FtsZ ring formation

Product: FtsZ-interacting protein, member of the divisome

Essential: no

Synonyms: ytwP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,029,729 → 3,031,417

Phenotypes of a mutant

• altered localization of FtsZ and PBP1]] PubMed
• growth defects, elongated cells PubMed
• the ezrA mutation is synthetically lethal with a sepF mutation PubMed
• a whiA ezrA double mutant grows poorly, and the cells are filamentous PubMed
• a zapA ezrA double mutant forms filamentous cells PubMed
• depletion of pdhA and deletion of ezrA have a strong synthetic defect in cell division PubMed

The protein

Catalyzed reaction/ biological activity

• inhibits FtsZ polymerization PubMed
• recruits PBP1]] to the division septum PubMed
• activates PrkC PubMed

Protein family

• EzrA family (single member, according to UniProt)

Effectors of protein activity

• degradation of EzrA involves FtsH PubMed

Structure

• 4UXV (the 60 kDa cytoplasmic domain) PubMed

Localization

• cell membrane (integral) PubMed
• 1 transmembrane domain at the N-terminus PubMed

Expression and Regulation

Operons

• Genes: ezrA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutively expressed PubMed

  Additional information

  • degradation of EzrA involves FtsH PubMed

Biological materials

Mutant

• MGNA-A428 (ytwP::erm), available at the NBRP B. subtilis, Japan
• 1A805 ( ezrA::kan), PubMed, available at BGSC
• 1A1279 (ezrA::spec), PubMed, available at BGSC
• 1A1280 (ezrA-gfp), PubMed, available at BGSC
• BKE29610 (ΔezrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG, downstream forward: _UP4_TAGATAATCACGACCATGAA
• BKK29610 (ΔezrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG, downstream forward: _UP4_TAGATAATCACGACCATGAA

References

Reviews

Loading

Original Publications

Loading