kinA

two-component sensor kinase, phosphorylates Spo0F, part of the phosphorelay

Locus: BSU_13990

Isoelectric point: 5.49

Molecular weight: 68.99 kDa

Protein length: 606 aa

Gene length: 1821 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms: spoIIF,spoIIJ,gsiC,scoD

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Two-component sensor kinase
• Information processing → Regulation of gene expression → phosphorelay → The kinases
• Lifestyles → Sporulation → phosphorelay → The kinases
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 1,470,026 → 1,471,846

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of Spo0F
• mainly active in the older, inner regions of a colony (with KinB) PubMed
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Domains

• three tandem PAS domains in the N-terminal region of KinA, the second PAS domain is the major N-terminal determinant of KinA dimerization PubMed
• the first PAS domain is required for NAD(⁺) binding PubMed
• 3 PAS domains (aa 3-73, aa 140-214, aa 265-335) (according to UniProt)
• 2 PAC domains (aa 77-116, aa 218-255) (according to UniProt)
• Histidine Kinase domain (aa 402-606) (according to UniProt)

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• interaction with PxpB or Sda inhibits autophosphorylation of KinA PubMed
• autophosphorylation is inhibited by SivA and BslA PubMed
• activated by interaction with NAD(⁺) that indicated poor respiratory activity of the cell PubMed, this has been falsified PubMed

Structure

• 2VLG (PAS domain)

Localization

• cytoplasm

Additional information

• the protein forms tetramers PubMed

Expression and Regulation

Operons

• Genes: kinA
  Description: PubMed

  Sigma factors

  • SigH: sigma factor, PubMed, in SigH regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon
  • stringent response: positive regulation, in stringent response

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • promoter-up mutations or high artificial expression that render kinA independent from SigH, allow sporulation at high salinity PubMed

Biological materials

Mutant

• BKE13990 (ΔkinA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA
• BKK13990 (ΔkinA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA

References

Reviews

Loading

Original Publications

Loading