You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ydfD [2018-02-10T08:42:18.000Z]
similar to transcriptional regulator (MocR/ GabR family)
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]Gene
Coordinates
583,589 → 585,037
The protein
Protein family
[[MocR/ GabR family]] [Pubmed|22020104]Paralogous protein(s)
none, but there are 7 members of the [[MocR/ GabR family]] in ''B. subtilis[SW|Domains]
N-terminal DNA-binding helix-turn-helix motif; C-terminal domain is homologous to PLP-binding large domain of aminotransferases.Biological materials
Mutant
MGNA-C144 (ydfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2142 NBRP B. subtilis, Japan]BKE05370 (Δ[gene|B1A95EAE40AFA40BF12EE9B41287921417A39562|ydfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCGGTCTCCTTAA, downstream forward: _UP4_TAACTTTTATATCCTTAAATBKK05370 (Δ[gene|B1A95EAE40AFA40BF12EE9B41287921417A39562|ydfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCGGTCTCCTTAA, downstream forward: _UP4_TAACTTTTATATCCTTAAATReferences