xylR

transcriptional repressor of the xylA-xylB and xynP-xynB operons

Locus: BSU_17590

Isoelectric point: 5.82

Molecular weight: 38.29 kDa

Protein length: 350 aa

Gene length: 1053 bp

Function: regulation of xylan and xylose utilization

Product: transcriptional repressor

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of xylan/ xylose
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 1,890,512 → 1,891,564

The protein

Catalyzed reaction/ biological activity

• transcription repression of the xylA-xylB and the xynP-xynB operons

Protein family

• ROK (NagC/XylR) family (with GmuE and GlcK, according to UniProt)

Paralogous protein(s)

• GlcK

Effectors of protein activity

• inducer: xylose

Structure

• 5F7R (Rok from Listeria monocytogenes, 28% identity) PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: xylR
  Description: PubMed

Biological materials

Mutant

• GP270 (erm), GP1302 (aphA3), available in the Stülke lab
• BKE17590 (ΔxylR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTCATCCACTCCATTTG, downstream forward: _UP4_TAATTTTTTATGGAATGGAC
• BKK17590 (ΔxylR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTCATCCACTCCATTTG, downstream forward: _UP4_TAATTTTTTATGGAATGGAC

Labs working on this gene/protein

• Wolfgang Hillen, Erlangen University, Germany

References

Loading