ywcA

similar to Na+-dependent acetate symporter

Locus: BSU_38240

Isoelectric point: 7.20

Molecular weight: 54.79 kDa

Protein length: 513 aa

Gene length: 1542 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ipa-31r

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Solute:sodium symporter family
• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Sodium-solute symporter
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,924,225 3,925,766

Phenotypes of a mutant

• ywcB-ywcA mutant has slightly reduced acetic acid transport PubMed
• ywcB-ywcA mutant shows earlier pellicle biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• the protein is involved in acetate transport PubMed
• the protein is not involved in proline transport PubMed

Protein family

• sodium:solute symporter (SSF) (TC 2.A.21) family (according to UniProt)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: ywcB-ywcA

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulation

  • expressed during sporulation (SigE) PubMed

Biological materials

Mutant

• MGNA-B229 (ywcA::erm), available at the NBRP B. subtilis, Japan
• available in Erhard Bremer's lab PubMed
• BKE38240 (ywcA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AAATAATAAAAAAGCAGTCA, downstream forward: _UP4_TAAAAAAAGCTCTCTTTATC
• BKK38240 (ywcA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AAATAATAAAAAAGCAGTCA, downstream forward: _UP4_TAAAAAAAGCTCTCTTTATC

References

Loading