cggR [2019-02-19 18:13:32]

repressor of the glycolytic gapA operon, DeoR family

Locus: BSU33950

Isoelectric point: 5.68

Molecular weight: 37.23 kDa

Protein length: 340 aa

Gene length: 1023 bp

Function: transcriptional regulator

Product: central glycolytic genes regulator

Essential: no

Synonyms: yvbQ

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Glycolysis
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Information processing → Regulation of gene expression → Regulators of core metabolism

Gene

Coordinates: 3,482,752 3,483,774

Phenotypes of a mutant

• suppresses the growth defect of glmR mutants on gluconeogenic substrates PubMed

The protein

Catalyzed reaction/ biological activity

• transcription repression of the glycolytic gapA operon

Protein family

• sorC transcriptional regulatory family (according to Swiss-Prot)

Domains

• DNA binding domain (H-T-H motif) (3756)

Effectors of protein activity

• fructose 1.6-bisphosphate PubMed and dihydroxyacetone phosphate, glucose-6-phosphate and fructose-6-phosphate PubMed act as inducer and result in release of CggR from the DNA

Structure

• 3BXH (in complex with fructose-6-phosphate) PubMed
• 2OKG (effector binding domain) PubMed

Localization

• cytoplasma PubMed

Expression and Regulation

Operons

• Genes: cggR-gapA-pgk-tpi-pgm-eno
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CggR: repression, PubMed, in CggR regulon

  Regulation

  • expression induced by glycolytic intermediates (CggR) CggR PubMed
  • the mRNA is processed between cggR and gapA by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

• Genes: cggR-gapA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CggR: repression, PubMed, in CggR regulon

  Regulation

  • expression induced by glucose (10 fold) (CggR) PubMed
  • the mRNA is processed between cggR and gapA by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-A463 (yvbQ::erm), available at the NBRP B. subtilis, Japan
• GP311 (in frame deletion), available in Jrg Stlke's lab
• SM-NB7 (cggR-spc), available in Anne Galinier's and Boris Grke's labs
• BKE33950 (cggR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
• BKK33950 (cggR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT

Expression vectors

• pGP705 (N-terminal His-tag, in pWH844), available in Jrg Stlke's lab

LacZ fusion

• pGP504 (in pAC7), pGP509 (in pAC6), available in Jrg Stlke's lab

Antibody

• available in Jrg Stlke's lab

Labs working on this gene/protein

• Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Reviews

Loading

Original Publications

Loading