mfd [2020-09-09 14:40:20]

transcription-repair coupling factor, eliminates genetic damage from transcriptionally active genes during sporulation, required for increased mutagenesis of lagging strand genes

Locus: BSU_00550

Isoelectric point: 5.37

Molecular weight: 133.59 kDa

Protein length: 1177 aa

Gene length: 3534 bp

Function: promotes strand-specific DNA repair by displacing

Product: transcription-repair coupling factor

Essential: no

E.C.: 3.6.4.-

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination
• Information processing → Genetics → DNA repair/ recombination → Other proteins
• Information processing → RNA synthesis and degradation → Transcription → Transcription elongation/ termination

Gene

Coordinates: 60,430 63,963

Phenotypes of a mutant

• in an mfd knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed PubMed
• strongly reduced stationary phase mutagenesis PubMed
• increased UV-induced mutagenesis via PolY1/ PolY2-mediated translesion synthesis PubMed
• the mutation suppresses the mucoid phenotype of motA or motB mutants PubMed
• sensitive to blue light-induced DNA damage PubMed
• sensitive to oxidative stress PubMed
• suppression of lethality of pcrA inactvation PubMed

The protein

Catalyzed reaction/ biological activity

• promotes strand-specific DNA repair by displacing RNA polymerase stalled at a nucleotide lesion and directing the (A)BC excinuclease to RNA damage site
• is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for CcpA PubMed and CodY PubMed)
• required for the processing of genetic damage during sporulation PubMed
• required for repair of DNA lesions during growth PubMed
• promotes error-prone DNA repair during stress to promote genetic diversity PubMed

Protein family

• N-terminal part: UvrB family (with UvrB, according to UniProt)
• C-terminal part: helicase family (according to UniProt)

Paralogous protein(s)

• RecU, RecG

Domains

• Helicase ATP-binding domain (aa 638-799) (according to UniProt)
• Helicase C-terminal domain (aa 820-974) (according to UniProt)

Structure

• 2EYQ (Mfd from E. coli) PubMed
• 3MLQ (RNA polymerase interacting domain of Thermus thermophilus Mfd with the Thermus aquaticus RpoB beta1 domain) PubMed

Localization

• cytoplasm (according to UniProt)

Additional information

• Mfd may interact with RNA polymerase PubMed

Expression and Regulation

Operons

• Genes: fin-mfd-spoVT
  Description: PubMed

Biological materials

Mutant

• GP1167 (del ermC), available in Jörg Stülke's lab PubMed
• BKE00550 (mfd::erm, available in the BGSC, in Fabian Commichau's, and in Jörg Stülke's labs) PubMed
• BKE00550 (mfd::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
• BKK00550 (mfd::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG

GFP fusion

• GP1510 (spc, based on pGP1870, pGP1389-derivative ), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab

Antibody

• **

References

Reviews

Loading

Original publications

Loading