guaB [2019-04-15 18:23:27]

IMP dehydrogenase

locus: BSU00090

pI: 6.17

mw: 52.82 kDa

protein length: 488 aa

gene length: 1467 bp

function: biosynthesis of GMP

product: IMP dehydrogenase

essential: no

ec: 1.1.1.205

synonyms: guaA

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
• [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]

Gene

Coordinates: 15,915 17,381

Phenotypes of a mutant

• essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
• reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]

The protein

Catalyzed reaction/ biological activity

• Inosine 5'-phosphate NAD H₂O = xanthosine 5'-phosphate NADH (according to Swiss-Prot)

Protein family

• IMPDH/GMPR family (together with [protein|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|GuaC]) (according to Swiss-Prot)

[SW|Domains]

• 2 [SW|CBS domain]s (95-153, 157-214)

Modification

• phosphorylated (STY) [Pubmed|17726680]
• Cys308 is S-cysteinylated after diamide stress [Pubmed|17611193], [Pubmed|17726680]
• Cys308 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]

Effectors of protein activity

• inhibition of enzymatic activity by (p)ppGpp during the 'stringent response'[Pubmed|22981860,6111556]

Structure

• [PDB|3TSB] (from ''B. anthracis'', 80% identity) [pubmed|22788966]

additional information

• belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

• genes: [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]

  regulation

  • activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]

additional information

• the mRNA is very stable (> 15 min) [pubmed|12884008]
• the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]

Biological materials

Mutant

• BKE00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
• BKK00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA

Expression vectors

• purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP901, available in [SW|Jörg Stülke]'s lab
• pGP2937 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

References

• 22938038,17611193,12884008,1722815,22981860,12618455,17726680,17726680,6111556,24163341,15378759,24682323,25572472,26883633,28189581