catE

catechol 2,3-dioxygenase, detoxification of environmental catechols, protects cells from intoxication by endogenous bacillibactin-derived catechol metabolites under iron-limited conditions

Locus: BSU_08240

Isoelectric point: 5.30

Molecular weight: 31.37 kDa

Protein length: 285 aa

Gene length: 858 bp

Function: detoxification of catechol

Product: catechol 2,3-dioxygenase

Essential: no

Synonyms: yfiE

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Detoxification reactions
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 898,010 898,867

Phenotypes of a mutant

• not viable in the presence of catechol PubMed

The protein

Catalyzed reaction/ biological activity

• catechol + O₂ --> (2Z,4E)-2-hydroxy-6-oxohexa-2,4-dienoate + H⁺ (according to UniProt)

Protein family

• extradiol ring-cleavage dioxygenase family (according to UniProt)

Domains

• 2 VOC domains (aa 9-126, aa 169-285) (according to UniProt)

Expression and Regulation

Operons

• Genes: catD-catE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • YodB: repression, PubMed, in YodB regulon
  • CatR: repression, PubMed, in CatR regulon
  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • strong induction by diamide and quinones (such as catechol) (YodB, CatR) PubMed
  • induced by iron starvation (Fur) PubMed

Biological materials

Mutant

• MGNA-C295 (yfiE::erm), available at the NBRP B. subtilis, Japan
• BKE08240 (catE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GGTCATGCTGCATGCCTCTT, downstream forward: _UP4_TAACTGCAATCCCCTTGCCG
• BKK08240 (catE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GGTCATGCTGCATGCCTCTT, downstream forward: _UP4_TAACTGCAATCCCCTTGCCG

References

Loading