ponA [2020-10-30 15:16:11]

class A penicillin-binding protein 1A/1B, contributes to cell elongation and cell division, required for the control of cell diameter (together with the Rod complex)

Locus: BSU_22320

Isoelectric point: 4.75

Molecular weight: 99.36 kDa

Protein length: 914 aa

Gene length: 2745 bp

Function: bifunctional glucosyltransferase/ transpeptidase, polymerizes and cross-links peptidoglycan

Product: penicillin-binding protein 1A/1B, member of the divisome

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Penicillin-binding proteins
• Cellular processes → Cell envelope and cell division → Cell shape
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,341,444 2,344,188

Phenotypes of a mutant

• prevents bulging of the cells when grown at low Mg²⁺ concentrations, suppresses the lethal effect of a mreB mutation PubMed
• deletion of ponA restores growth and normal shape of a glmR mutant on gluconeogenic carbon sources PubMed
• a strain lacking all four class A penicillin-binding proteins (ponA pbpD pbpF pbpG) is severely inhibited for L-form switching in the presence of D-cycloserine PubMed

The protein

Catalyzed reaction/ biological activity

• [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H⁺ (according to UniProt)
• Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
• contributes to the control of cell diameter (cell diameter increases with PonA levels), acts antogonistically to the Rod complex PubMed

Protein family

• N-terminal part: glycosyltransferase 51 family (according to UniProt)
• C-terminal part: transpeptidase family (according to UniProt)

Paralogous protein(s)

• PbpD, PbpF, PbpG

Domains

• Fibronectin type-III (aa 708-795) (according to UniProt)

Structure

• 3DWK (from Staphylococcus aureus, aa 71 ... 656, 38% identity) PubMed

Localization

• membrane associated PubMed
• anchored to the membrane, the major part is exposed to the outside (according to UniProt)
• localizes to the spore septum during sporulation PubMed
• during vegetative growth: septal, low flourescence at periphery PubMed
• localizes to the vegetative septum PubMed, this depends on GlmR PubMed

Expression and Regulation

Operons

• Genes: recU-ponA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutive during vegetative growth PubMed

Biological materials

Mutant

• BKE22320 (ponA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC
• BKK22320 (ponA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC

GFP fusion

• 2083 trpC2 ponA::pSG1492 (cat P_xyl-gfpa-ponA1-394) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab

Labs working on this gene/protein

• Jeff Errington, Newcastle University, UK homepage

References

Reviews

Loading

Original publications

Loading