SubtiBank SubtiBank
ponA [2020-10-30 15:16:11]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ponA [2020-10-30 15:16:11]

class A penicillin-binding protein 1A/1B, contributes to cell elongation and [SW|cell division], required for the control of cell diameter (together with the [SW|Rod complex])
locus
BSU_22320
pI
4.75
mw
99.36 kDa
protein length
914 aa Sequence Blast
gene length
2745 bp Sequence Blast
function
bifunctional glucosyltransferase/ transpeptidase, polymerizes and cross-links peptidoglycan
product
penicillin-binding protein 1A/1B, member of the [SW|divisome]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,341,444 2,344,188

    Phenotypes of a mutant

  • prevents bulging of the cells when grown at low Mg2+ concentrations, suppresses the lethal effect of a [gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] mutation [Pubmed|19192185]
  • deletion of [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] restores growth and normal shape of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant on gluconeogenic carbon sources [Pubmed|21320184]
  • a strain lacking all four class A [SW|penicillin-binding proteins] ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] [gene|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD] [gene|73275060537497E6A9859856C9F040763E36316B|pbpF] [gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]) is severely inhibited for L-form switching in the presence of D-cycloserine [pubmed|29456081]
  • The protein

    Catalyzed reaction/ biological activity

  • [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H+ (according to UniProt)
  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
  • contributes to the control of cell diameter (cell diameter increases with PonA levels), acts antogonistically to the [SW|Rod complex] [pubmed|31086310]
  • Protein family

  • N-terminal part: [SW|glycosyltransferase 51 family] (according to UniProt)
  • C-terminal part: [SW|transpeptidase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|PbpD], [protein|73275060537497E6A9859856C9F040763E36316B|PbpF], [protein|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|PbpG]
  • [SW|Domains]

  • Fibronectin type-III (aa 708-795) (according to UniProt)
  • Structure

  • [PDB|3DWK] (from Staphylococcus aureus, aa 71 ... 656, 38% identity) [pubmed|18760285]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • anchored to the membrane, the major part is exposed to the outside (according to UniProt)
  • localizes to the spore septum during sporulation [Pubmed|15758244,15262952]
  • during vegetative growth: septal, low flourescence at periphery [pubmed|14731276]
  • localizes to the vegetative septum [Pubmed|15262952], this depends on [protein|7150BABA5086D5E2EB8102E4901A216F43576282|GlmR] [Pubmed|21320184]
  • Expression and Regulation

    Operons

    genes
    [gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]-[gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]
    description
    [Pubmed|7814321]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive during vegetative growth [Pubmed|15758244]
  • view in new tab

    Biological materials

    Mutant

  • BKE22320 ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC
  • BKK22320 ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC
  • GFP fusion

  • 2083 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::pSG1492 (cat Pxyl-gfpa-[gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]1-394) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jeff Errington] lab
  • labs

  • [SW|Jeff Errington], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/jeff.errington homepage]
  • References

    Reviews

  • 21371139
  • Original publications

  • 8606187,15262952,9721295,10322023,7814321,18363795,14731276,21320184,18763711,19192185,18179421,23531131,18363795,18760285,29456081,30651563,31086310,32662773