curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, [SW|cell division] initiation protein (septum placement), part of the Min system (with Z ring placement)
function
septum placement
product
[SW|cell division] initiation protein
Genomic Context
categories
[category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.1|The Min system][category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]Gene
Coordinates
1,612,521 1,613,015
Phenotypes of a mutant
Deletion of ''divIVA'' leads to filamentation and polar divisions that in turn cause a minicell phenotype. [Pubmed|9219999]A ''divIVA'' mutant has a moderate [(Pubmed)|26735940] to severe [(Pubmed)|11445541] [SW|sporulation] defect.The protein
Catalyzed reaction/ biological activity
curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septumDivIVA is required for polar localisation of [protein|8C94C9598A823A8405B3E1FA0124E21D90845B8E|MinC]-[protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|MinD] via [protein|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|MinJ]. [Pubmed|19019154]It also recruits [protein|09E9194E82DF199527F414DB0EC15547A71AD25E|RacA] to the distal pole of the prespore [Pubmed|12493822].DivIVA may anchor [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] briefly to the assembling polar septum before [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] is subsequently released into the forespore membrane and recaptured at the polar septum [Pubmed|25101664]required for the compartment-specific activation of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] [Pubmed|25101664]activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|25845974]required for oriC placement during spore development [Pubmed|27059541]Protein family
gpsB family (according to Swiss-Prot)Paralogous protein(s)
[protein|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|GpsB] [SW|Domains]
the first 60 amino acids constitute a conserved lipid binding domain. [Pubmed|19478798]the C-terminal domain is less conservedmultimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain [Pubmed|18388125] [Pubmed|23264578]Modification
phosphorylated on Arg-102 [Pubmed|22517742]The ''Mycobacterium'' DivIVA homologue Wag31 is phosphorylated at T73 [Pubmed|15985609]DivIVA from ''Streptococcus pneumoniae'' is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. [Pubmed|20453092][Pubmed|22211696][SW|Cofactors]
not knownEffectors of protein activity
not knownStructure
[PDB|2WUJ] (N-terminal domain) [Pubmed|20502438][SW|Localization]
DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles [Pubmed|9219999].forms rings at the division septum and patches at the cell poles [Pubmed|22108385]membrane targeting requires [protein|AD7CD451B4AE638A719C91780339784A7FF0F248|SecA] [Pubmed|24592260]assembles into a ring-like structure at the polar septum during [SW|sporulation] [Pubmed|25101664]Expression and Regulation
Operons
genes
[gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]
description
[Pubmed|16420366]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]regulation
constitutively expressed [Pubmed|23701187]view in new tabBiological materials
Mutant
4041 (''divIVA''::''tet''), available in [SW|Leendert Hamoen]'s, [SW|Jrg Stlke]'s, and [SW|Sven Halbedel] 's labGP1482 (chromosomal ''divIVA''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jrg Stlke]'s labBKE15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTGBKK15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTGExpression vectors
DivIVA-Strep available [http://www.rki.de/DE/Content/Institut/OrgEinheiten/Abt1/FG11/AG_LM.html here]pGP1497 (N-terminal Strep-tag fused to C-terminus of ''divIVA'', TEV-site, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jrg Stlke]'s labGFP fusion
divIVA-gfp fusions available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Sven Halbedel]'s and [SW|Jrg Stlke]'s labsFLAG-tag construct
GP1776 (spc, based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s labAntibody
A polyclonal anti-DivIVA antiserum generated in rabbit is described here [Pubmed|11445541].labs
[SW|Leendert Hamoen], Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen x][SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [http://imb.savba.sk/~barak/ homepage][SW|Sven Halbedel], Robert Koch Institute [http://www.rki.de/DE/Content/Institut/OrgEinheiten/Abt1/FG11/AG_LM.html homepage]References
Reviews
19654604,19884039,22722244,23182676,28697666,29355854,29522747 Original Publications
22582279,19654604,19666580,9219999,19019154,15554965,12368265,11445541,10835369,12511520,14651647,19478798,19429628,11445541,9219999,9045828,20352045,20502438,11886553,21564336,22108385,22457634,22517742,22661688,23264578,23701187,23927765,24391905,24592260,24600441,25101664,25845974,27059541,26735940,28674273