divIVA [2020-08-10 10:49:30]

curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, cell division initiation protein (septum placement), part of the Min system (with Z ring placement)

Locus: BSU_15420

Isoelectric point: 4.85

Molecular weight: 19.20 kDa

Protein length: 164 aa

Gene length: 495 bp

Function: division site selection, chromosome segregation and control of peptidoglycan homeostasis

Product: cell division initiation protein, member of the divisome

Essential: no

Synonyms: ylmJ

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → The Min system
• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 1,612,521 1,613,015

Phenotypes of a mutant

• Deletion of divIVA leads to filamentation and polar divisions that in turn cause a minicell phenotype PubMed
• A divIVA mutant has a moderate PubMed to severe PubMed sporulation defect

The protein

Catalyzed reaction/ biological activity

• curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum
• DivIVA is required for polar localisation of MinC-MinD via MinJ. PubMed
• It also recruits RacA to the distal pole of the prespore PubMed.
• DivIVA may anchor SpoIIE briefly to the assembling polar septum before SpoIIE is subsequently released into the forespore membrane and recaptured at the polar septum PubMed
• required for the compartment-specific activation of SigF PubMed
• activates PrkC PubMed
• required for oriC placement during spore development PubMed

Protein family

• DivIVA family (single member, according to UniProt)

Paralogous protein(s)

• GpsB

Domains

• the first 60 amino acids constitute a conserved lipid binding domain PubMed
• the C-terminal domain is less conserved
• multimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain PubMed PubMed

Modification

• phosphorylated on Arg-102 PubMed
• The Mycobacterium DivIVA homologue Wag31 is phosphorylated at T73 PubMed
• DivIVA from Streptococcus pneumoniae is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. PubMedPubMed

Cofactors

• not known

Effectors of protein activity

• not known

Structure

• 2WUJ (N-terminal domain) PubMed

Localization

• DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles PubMed
• forms rings at the division septum and patches at the cell poles PubMed
• membrane targeting requires SecA PubMed
• assembles into a ring-like structure at the polar septum during sporulation PubMed

Expression and Regulation

Operons

• Genes: divIVA
  Description: PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• 4041 (divIVA::tet), available in Leendert Hamoen's, Jörg Stülke's, and Sven Halbedel 's lab
• GP1482 (chromosomal divIVA-Strep fusion, aphA3), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab
• BKE15420 (divIVA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG
• BKK15420 (divIVA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG

Expression vectors

• DivIVA-Strep available here
• pGP1497 (N-terminal Strep-tag fused to C-terminus of divIVA, TEV-site, purification from E. coli, in pGP172), available in Jörg Stülke's lab

GFP fusion

• divIVA-gfp fusions available from the Hamoen Lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Sven Halbedel's and Jörg Stülke's labs

FLAG-tag construct

• GP1776 (spc, based on pGP1331), available in Jörg Stülke's lab

Antibody

• A polyclonal anti-DivIVA antiserum generated in rabbit is described here PubMed.

Labs working on this gene/protein

• Leendert Hamoen, Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom x
• Imrich Barak, Slovak Academy of Science, Bratislava, Slovakia homepage
• Sven Halbedel, Robert Koch Institute homepage

References

Reviews

Loading

Original Publications

Loading