yflA [2020-10-27 12:19:57]

general stress protein, similar to amino acid carrier protein, required for protection against paraquat stress

Locus: BSU_07750

Isoelectric point: 9.86

Molecular weight: 50.48 kDa

Protein length: 471 aa

Gene length: 1416 bp

Function: protection against paraquat stress

Product: unknown

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Alanine or glycine cation symporter family
• Cellular processes → Transporters → Transporters/ other → Other transporters
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 844,770 846,185

The protein

Protein family

• Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family (according to UniProt)

Paralogous protein(s)

• AlsT, GlnT, YrbD

Structure

• 6CSE (sodium/alanine symporter from Methanococcus maripaludis S2, 37% identity) PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: yflA
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon

  Regulatory mechanism

  • Abh: repression, in Abh regulon
  • AbrB: repression, in AbrB regulon

• Genes: yflD-yflB-yflA
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon

Biological materials

Mutant

• MGNA-C257 (yflA::erm), available at the NBRP B. subtilis, Japan
• BKE07750 (yflA::erm trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
• BKK07750 (yflA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC

References

Loading