cysI

sulfite reductase (NADPH₂) (beta subunit)

Locus: BSU_33430

Isoelectric point: 5.49

Molecular weight: 64.63 kDa

Protein length: 571 aa

Gene length: 1716 bp

Function: sulfite reduction

Product: sulfite reductase (NADPH₂)

Essential: no

Synonyms: yvgR

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Sulfur metabolism
• Metabolism → Additional metabolic pathways → Sulfur metabolism → sulfur metabolism/ general

Gene

Coordinates: 3,430,598 3,432,313

Phenotypes of a mutant

• unable to grow with sulfate or sulfite as the only sulfur source PubMed

The protein

Catalyzed reaction/ biological activity

• 3 H₂O + hydrogen sulfide + 3 NADP⁺ --> 4 H⁺ + 3 NADPH + sulfite (according to UniProt)

Protein family

• nitrite and sulfite reductase 4Fe-4S domain family (with NasD, according to UniProt)

Cofactors

• Fe-S cluster PubMed
• heme PubMed

Structure

• 6C3M (from E. coli, 52% identity) PubMed

Expression and Regulation

Operons

• Genes: cysI-cysJ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CysL: activation, PubMed, in CysL regulon

  Regulation

  • induced by sulfite, sulfate, and thiosulfate (CysL) PubMed

Biological materials

Mutant

• MGNA-B602 (yvgR::erm), available at the NBRP B. subtilis, Japan
• 1A802 ( cysI::kan), PubMed, available at BGSC
• 1A934 ( cysI::kan), PubMed, available at BGSC
• BKE33430 (cysI::erm, available in the BGSC, in Fabian Commichau's, and in Jörg Stülke's lab) PubMed
• BKE33430 (cysI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
• BKK33430 (cysI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA

References

Loading