SubtiBank SubtiBank
recA [2020-03-05 10:18:33]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

recA [2020-03-05 10:18:33]

multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts
Locus
BSU_16940
Isoelectric point
4.88
Molecular weight
37.93 kDa
Protein length
348 aa Sequence Blast
Gene length
1047 bp Sequence Blast
Function
DNA repair/ recombination
Product
multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage)
Essential
no
Synonyms
recE

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
1,764,645 1,765,691

Phenotypes of a mutant

  • slower growth PubMed
  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed
  • reduced sporulation efficiency PubMed
  • strongly reduced chromosomal transformation rate PubMed
  • no amplification of the gltA-gltB chromosomal region to suppress the glutamate auxotrophy of a gltC mutant PubMed
  • sensitive to Cr(VI) treatment PubMed
  • reduced resistance towards electron beams PubMed
  • The protein

    Catalyzed reaction/ biological activity

  • RecA stimulates ssDNA phosphorylase activity of PnpA PubMed
  • RecA-ATP in concert with DprA and SsbA catalyzes DNA strand exchange, with SsbB as an accessory factor PubMed
  • RecA-dATP catalyzes strand exchange even in the absence of the accessory factors PubMed
  • protects sporulating cells from DNA damage PubMed
  • contributes to transfection with naked phage DNA PubMed
  • RecA polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with RecD2 helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule PubMed
  • Protein family

  • RecA family (together with RadA) (according to UniProt)
  • Modification

  • phosphorylated on Arg-58 PubMed
  • phosphorylated on Ser-2 PubMed by YabT PubMed
  • Effectors of protein activity

  • RecO and DprA provide RecA access to ssDNA during chromosomal transformation PubMed
  • interaction with DisA inhibits RecA filament growth and RecA-mediated DNA strand exchange PubMed
  • Structure

  • 1UBC (RecA from Mycobacterium smegmatis, 67% identity) PubMed
  • Localization

  • colocalizes to the replisome in response to endogenous and exogenous DNA damage and in response to damage-independent fork arrest (formation of DNA repair centers), repair center formation depends on RecO and RecR, and is facilitated by RecF and SsbA PubMed
  • Nucleoid (Mid-cell) PubMed
  • localizes to one cell pole PubMed
  • co-localizes with the DNA uptake machinery PubMed
  • forms a transient, mobile focus associated with the chromosome during spore development PubMed
  • Additional information

  • belongs to the 100 most abundant proteins PubMed
  • Expression and Regulation

    Operons

    Genes
    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • Regulatory mechanism

  • LexA: repression, PubMed, in LexA regulon
  • ComK: activation, PubMed, in ComK regulon
  • Regulation

  • induced by conditions that trigger development of genetic competence (ComK) PubMed
  • expression is induced in the presence of Cr(VI) PubMed
  • view in new tab

    Biological materials

    Mutant

  • IRN444 (cat), available in Jörg Stülke's lab
  • GP2542(ΔrecA::spc trpC2), available in Jörg Stülke's lab
  • 1A746 (ΔrecA::erm), PubMed, available at the Bacillus Genetic Stock Center
  • 1A786 (ΔrecA::kan), PubMed, available at the Bacillus Genetic Stock Center
  • BP469 (ΔrecA::erm), available in Fabian Commichau's lab
  • BKE16940 (recA::erm, available in the Bacillus Genetic Stock Center, in Fabian Commichau's, and in Jörg Stülke's labs) PubMed
  • BKE16940 (recA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
  • BKK16940 (recA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Ulf Gerth's lab
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab
  • Labs working on this gene/protein

  • Peter Graumann, Freiburg University, Germany homepage
  • References

    Reviews

    Loading

    Original publications

    Loading