You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
recA [2020-09-09 14:37:41]
multifunctional protein involved in homologous recombination and DNA repair (
LexA-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts
Molecular weight
37.93 kDa
Function
DNA repair/ recombination
Product
multifunctional protein involved in homologous recombination and DNA repair (
LexA-autocleavage)
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,764,645 1,765,691
Phenotypes of a mutant
slower growth PubMeddrastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMedreduced sporulation efficiency PubMedstrongly reduced chromosomal transformation rate PubMedno amplification of the gltA-gltB chromosomal region to suppress the glutamate auxotrophy of a gltC mutant PubMedsensitive to Cr(VI) treatment PubMedreduced resistance towards electron beams PubMedreduced viability of a rarA recA double mutant PubMed The protein
Catalyzed reaction/ biological activity
RecA stimulates ssDNA phosphorylase activity of PnpA PubMedRecA-ATP in concert with DprA and SsbA catalyzes DNA strand exchange, with SsbB as an accessory factor PubMedRecA-dATP catalyzes strand exchange even in the absence of the accessory factors PubMedprotects sporulating cells from DNA damage PubMedcontributes to transfection with naked phage DNA PubMedRecA polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with RecD2 helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule PubMed Protein family
RecA family (together with RadA) (according to UniProt) Modification
Effectors of protein activity
Structure
1UBC (RecA from Mycobacterium smegmatis, 67% identity) PubMed Localization
colocalizes to the replisome in response to endogenous and exogenous DNA damage and in response to damage-independent fork arrest (formation of DNA repair centers), repair center formation depends on RecO and RecR, and is facilitated by RecF and SsbA PubMedNucleoid (Mid-cell) PubMedlocalizes to one cell pole PubMedco-localizes with the DNA uptake machinery PubMedforms a transient, mobile focus associated with the chromosome during spore development PubMed Additional information
Expression and Regulation
Operons
Sigma factors
Regulatory mechanism
Regulation
induced by conditions that trigger development of genetic competence (ComK) PubMedexpression is induced in the presence of Cr(VI) PubMed view in new tabBiological materials
Mutant
IRN444 (cat), available in Jörg Stülke's labGP2542(ΔrecA::spc trpC2), available in Jörg Stülke's lab1A746 (ΔrecA::erm), PubMed, available at the Bacillus Genetic Stock Center1A786 (ΔrecA::kan), PubMed, available at the Bacillus Genetic Stock CenterBP469 (ΔrecA::erm), available in Fabian Commichau's labBKE16940 (recA::erm, available in the Bacillus Genetic Stock Center, in Fabian Commichau's, and in Jörg Stülke's labs) PubMedBKE16940 (recA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCABKK16940 (recA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Ulf Gerth's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading