dgcW [2019-02-19 18:02:49]

diguanylate cyclase and potential phosphodiesterase

Locus: BSU13420

Isoelectric point: 6.82

Molecular weight: 84.63 kDa

Protein length: 749 aa

Gene length: 2250 bp

Function: synthesis of c-di-GMP

Product: diguanylate cyclase and potential phosphodiesterase

Essential: no

Synonyms: ykoW

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,407,329 1,409,578

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-GMP from two molecules of GTP PubMed

Domains

• contains a N-terminal PAS domain PubMed
• contains a central GGDEF domain and a C-terminal EAL domain PubMed
• aa 290-735 are similar to E. coli CsrD (18% identity, 43% similarity)

Structure

• 5XGB (from Pseudomonas aeruginosa, corresponds to the C-terminal part of DgcW, aa 194 ... 735, 29% identity) PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: dgcW
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

Biological materials

Mutant

• MGNA-B314 (ykoW::erm), available at the NBRP B. subtilis, Japan
• GP850 (dgcW::cat), available in Jrg Stlke's lab PubMed
• BP140 (dgcW::ermC) available in Fabian Commichau's lab
• BP142 (dgcW-ykoV-ligD::kan) available in Fabian Commichau's lab
• BKE13420 (dgcW::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
• BKK13420 (dgcW::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab

References

Loading