crh [2018-02-13 09:34:59]

"Carbon-flux regulating HPr", formerly known as "Catabolite repression HPr-like protein", control of flux through the harmful methylglyoxal pathway, minor cofactor of the CcpA transcription factor

Locus: BSU34740

Isoelectric point: 4.70

Molecular weight: 9.19 kDa

Protein length: 85 aa

Gene length: 255 bp

Function: control of carbon flux

Product: carbon-flux regulating HPr

Essential: no

Synonyms: yvcM

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 3,569,292 → 3,569,549

The protein

Protein family

• HPr]] family

Paralogous protein(s)

• HPr]]

Domains

• HPr]] domain (1–85)

Modification

• phosphorylation on Ser46 by HprK PubMed

Structure

• 2AK7 (dimeric Crh-Ser46-P)
• 1ZVV (CcpA-Crh-DNA complex)
• 2RLZ (dimer)
• 1MU4
• NCBI, dimer
• NCBI, CcpA-Crh-DNA complex
• NCBI, dimeric phosphor-Crh
• NCBI

Additional information

• Crh does not possess the phosphorylation site used for PtsI phosphotransfer (His-15 in PtsH), it can only be phosphorylated on Ser-46

Expression and Regulation

Operons

• Genes: nahA-yvcJ-glmR-whiA-crh-yvcN
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, in CcpA regulon

  Regulation

  • constitutive expression at both protein and RNA levels PubMed

  Additional information

  • A ncRNA is predicted between 'yvcI' and 'trxB' PubMed

Biological materials

Mutant

• GP860 (aphA3) PubMed, QB7097 (spc), available in Jörg Stülke's lab
• BKE34740 (Δcrh::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
• BKK34740 (Δcrh::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT

Expression vector

• pGP641 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
• pGP734 (C-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP382), available in Jörg Stülke's lab

LacZ fusion

• see ''nahA

Two-hybrid system

• crh, crh(Ser46Asp), crh(Ser46Ala) B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Boris Görke, University of Göttingen, Germany
• Homepage
• Anne Galinier, University of Marseille, France
• Wolfgang Hillen, Erlangen University, Germany Homepage
• Richard Brennan, Houston, Texas, USA Homepage

References

Loading