yrbD

sodium/proton-dependent alanine transporter

Locus: BSU_27810

Isoelectric point: 9.38

Molecular weight: 51.43 kDa

Protein length: 484 aa

Gene length: 1455 bp

Function: uptake of alanine

Product: sodium/proton-dependent alanine transporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Alanine or glycine cation symporter family
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of serine/ glycine/ alanine
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of alanine/ serine
• Lifestyles → Sporulation → Sporulation proteins → Newly identified sporulation proteins (based on transcription profiling)

Gene

Coordinates: 2,841,611 2,843,065

The protein

Protein family

• Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family (according to UniProt)

Paralogous protein(s)

• YflA, AlsT, GlnT

Structure

• 6CSE (sodium/alanine symporter from Methanococcus maripaludis S2, 37% identity) PubMed

Expression and Regulation

Operons

• Genes: yrbD
  Description: PubMed

  Regulatory mechanism

  • TnrA: activation, in TnrA regulon

Biological materials

Mutant

• GP3556 (ΔyrbD::phleo), available in Jörg Stülke's lab
• MGNA-A821 (yrbD::erm), available at the NBRP B. subtilis, Japan
• BKE27810 (yrbD::erm trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CATCAAGCTTCCCCCTCACT, downstream forward: _UP4_TGAACATACTAAAACCGGCC
• BKK27810 (yrbD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCAAGCTTCCCCCTCACT, downstream forward: _UP4_TGAACATACTAAAACCGGCC

References

Loading